Antimicrobial Resistant Bacteria in Shrimp and Shrimp Farms of Bangladesh
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sampling Area and Sample Collection
2.2. Isolation Procedure for Escherichia coli, Salmonella spp. and Vibrio spp.
2.3. DNA Extraction and Quantitative PCR
2.4. Antibiotic Resistance Test
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Igbinosa, E.O.; Beshiru, A. Antimicrobial resistance, virulence determinants, and biofilm formation of Enterococcus species from ready-to-eat seafood. Front. Microbiol. 2019, 10, 728. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thornber, K.; Verner-Jeffreys, D.; Hinchliffe, S.; Rahman, M.M.; Bass, D.; Tyler, C.R. Evaluating antimicrobial resistance in the global shrimp industry. Rev. Aquac. 2020, 12, 966–986. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hinchliffe, S.; Butcher, A.; Rahman, M.M. The AMR problem: Demanding economies, biological margins, and co-producing alternative strategies. Palgrave Commun. 2018, 4, 142. [Google Scholar] [CrossRef] [Green Version]
- Hoelzer, K.; Wong, N.; Thomas, J.; Talkington, K.; Jungman, E.; Coukell, A. Antimicrobial drug use in food-producing animals and associated human health risks: What, and how strong, is the evidence? BMC Vet. Res. 2017, 13, 211. [Google Scholar] [CrossRef] [PubMed]
- Bassetti, M.; Ginocchio, F.; Mikulska, M. New treatment options against gram-negative organisms. In Annual Update in Intensive Care and Emergency Medicine; Springer: Berlin/Heidelberg, Germany, 2011; pp. 501–515. [Google Scholar]
- Su, H.; Liu, S.; Hu, X.; Xu, X.; Xu, W.; Xu, Y.; Li, Z.; Wen, G.; Liu, Y.; Cao, Y. Occurrence and temporal variation of antibiotic resistance genes (ARGs) in shrimp aquaculture: ARGs dissemination from farming source to reared organisms. Sci. Total Environ. 2017, 607, 357–366. [Google Scholar] [CrossRef] [PubMed]
- Prichula, J.; Pereira, R.I.; Wachholz, G.R.; Cardoso, L.A.; Tolfo, N.C.C.; Santestevan, N.A.; Medeiros, A.W.; Tavares, M.; Frazzon, J.; d’Azevedo, P.A. Resistance to antimicrobial agents among enterococci isolated from fecal samples of wild marine species in the southern coast of Brazil. Mar. Pollut. Bull. 2016, 105, 51–57. [Google Scholar] [CrossRef] [PubMed]
- Silva, I.P.; de Souza Carneiro, C.; Saraiva, M.A.F.; de Oliveira, T.A.S.; de Sousa, O.V.; Evangelista-Barreto, N.S. Antimicrobial resistance and potential virulence of Vibrio parahaemolyticus isolated from water and bivalve mollusks from Bahia, Brazil. Mar. Pollut. Bull. 2018, 131, 757–762. [Google Scholar] [CrossRef]
- Binh, V.N.; Dang, N.; Anh, N.T.K.; Thai, P.K. Antibiotics in the aquatic environment of Vietnam: Sources, concentrations, risk and control strategy. Chemosphere 2018, 197, 438–450. [Google Scholar] [CrossRef] [Green Version]
- Le, T.X.; Munekage, Y.; Kato, S.-I. Antibiotic resistance in bacteria from shrimp farming in mangrove areas. Sci. Total Environ. 2005, 349, 95–105. [Google Scholar] [CrossRef] [PubMed]
- Tendencia, E.A.; de la Peña, L.D. Antibiotic resistance of bacteria from shrimp ponds. Aquaculture 2001, 195, 193–204. [Google Scholar] [CrossRef]
- Bermúdez-Almada, M.; Espinosa-Plascencia, A. The Use of Antibiotics in Shrimp Farming; Books on Demand: Norderstedt, Germany, 2012; pp. 199–214. [Google Scholar]
- MacFadden, D.R.; McGough, S.F.; Fisman, D.; Santillana, M.; Brownstein, J.S. Antibiotic resistance increases with local temperature. Nat. Clim. Chang. 2018, 8, 510–514. [Google Scholar] [CrossRef]
- FAO. FishStatJ-Software for fishery and aquaculture statistical time series. In FAO Fisheries Division; Food and Agriculture Organization: Rome, Italy, 2020; Volume 22. [Google Scholar]
- Sundaramanickam, A.; Kumar, P.S.; Kumaresan, S.; Balasubramanian, T. Isolation and molecular characterization of multidrug-resistant halophilic bacteria from shrimp farm effluents of Parangipettai coastal waters. Environ. Sci. Pollut. Res 2015, 22, 11700–11707. [Google Scholar] [CrossRef] [PubMed]
- Chereau, F.; Opatowski, L.; Tourdjman, M.; Vong, S. Risk assessment for antibiotic resistance in South East Asia. BMJ 2017, 358, j3393. [Google Scholar] [CrossRef] [Green Version]
- Marshall, B.M.; Levy, S.B. Food animals and antimicrobials: Impacts on human health. Clin. Microbiol. Rev. 2011, 24, 718–733. [Google Scholar] [CrossRef] [Green Version]
- Thuy, H.T.T.; Nga, L.P.; Loan, T.T.C. Antibiotic contaminants in coastal wetlands from Vietnamese shrimp farming. Environ. Sci. Pollut. Res. 2011, 18, 835–841. [Google Scholar] [CrossRef]
- Shamsuzzaman, M.M.; Biswas, T.K. Aqua chemicals in shrimp farm: A study from south-west coast of Bangladesh. Egypt. J. Aquat. Res. 2012, 38, 275–285. [Google Scholar] [CrossRef] [Green Version]
- Neela, F.A.; Rahman, M.A.; Banu, M.N.A.; Rahman, M.H.; Ohta, H.; Alam, M.F. Occurrence of antibiotic resistant bacteria in some shrimp farms of Bangladesh. Bangladesh J. Bot. 2012, 41, 197–200. [Google Scholar] [CrossRef] [Green Version]
- Mandal, S.C.; Hasan, M.; Rahman, M.S.; Manik, M.H.; Mahmud, Z.H.; Islam, M.S. Coliform bacteria in Nile Tilapia, Oreochromis niloticus of shrimp-Gher, pond and fish market. World J. Fish Mar. Sci. 2009, 1, 160–166. [Google Scholar]
- Chakravarty, M.S.; Ganesh, P.; Amaranth, D.; Shanthi Sudha, B.; Subhashini, M. Escherichia coli-occurrence in the meat of shrimp, fish, chicken and mutton and its antibiotic resistance. Eur. J. Exp. Biol. 2015, 5, 41–48. [Google Scholar]
- Ray, B.; Bhunia, A.K. Fundamental Food Microbiology; CRC Press: Boca Raton, FL, USA, 2001; Volume 97. [Google Scholar]
- US Food & Drug Administration. Import Alert 16-81. 2022. Available online: https://www.accessdata.fda.gov/cms_ia/importalert_35.html (accessed on 23 July 2022).
- Beshiru, A.; Igbinosa, I.H.; Igbinosa, E.O. Prevalence of antimicrobial resistance and virulence gene elements of Salmonella serovars from ready-to-eat (RTE) shrimps. Front. Microbiol. 2019, 10, 1613. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Patel, A.; Jeyasekaran, G.; Jeyashakila, R.; Anand, T.; Wilwet, L.; Pathak, N.; Malini, A.H.; Neethiselvan, N. Prevalence of antibiotic resistant Salmonella spp. strains in shrimp farm source waters of Nagapattinam region in South India. Mar. Pollut. Bull. 2020, 155, 111171. [Google Scholar] [CrossRef] [PubMed]
- Gopal, S.; Otta, S.K.; Kumar, S.; Karunasagar, I.; Nishibuchi, M.; Karunasagar, I. The occurrence of Vibrio species in tropical shrimp culture environments; implications for food safety. Int. J. Food Microbiol. 2005, 102, 151–159. [Google Scholar] [CrossRef]
- Alday-Sanz, V. The Shrimp Book; Nottingham University Press: Nottingham, UK, 2010. [Google Scholar]
- Thakur, N.; Nath, A.K.; Chauhan, A.; Gupta, R. Purification, characterization, and antifungal activity of Bacillus cereus strain NK91 chitinase from rhizospheric soil samples of Himachal Pradesh, India. Biotechnol. Appl. Biochem. 2021. [CrossRef]
- Andrew, W.; Wang, H.; Jacobson, A.; Hammack, T. Bacteriological Analytical Manual (BAM): Salmonella; U.S. Food and Drug Administration: White Oak, MD, USA, 2018. [Google Scholar]
- Kaysner, C.; DePaola, A.; Jones, J. Vibrio. In Bacteriological Analytical Manual (BAM); U.S. Food and Drug Administration: White Oak, MD, USA, 2004. [Google Scholar]
- Hannan, M.A.; Rahman, M.M.; Mondal, M.N.; Chandra, D.S.; Chowdhury, G.; Islam, M.T. Molecular identification of causing vibriosis in shrimp and its herbal remedy. Pol. J. Microbiol. 2019, 68, 429–438. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rahman, M.; Rahman, M.; Deb, S.C.; Alam, M.; Islam, M. Molecular identification of multiple antibiotic resistant fish pathogenic Enterococcus faecalis and their control by medicinal herbs. Sci. Rep. 2017, 7, 3747. [Google Scholar] [CrossRef] [Green Version]
- Costa, R.A.; Araújo, R.L.; Souza, O.V.; Vieira, R.H.S.D.F. Antibiotic-resistant Vibrios in farmed shrimp. BioMed Res. Int. 2015, 2015, 505914. [Google Scholar]
- Hudzicki, J. Kirby-Bauer Disk Diffusion Susceptibility Test Protocol; American Society for Microbiology: Washington, DC, USA, 2009; pp. 55–63. [Google Scholar]
- Weinstein, M.P. Performance Standards for Antimicrobial Susceptibility Testing; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2021. [Google Scholar]
- Kishore, J. Isolation, identification & characterization of Proteus penneri-a missed rare pathogen. Indian J. Med. Res. 2012, 135, 341. [Google Scholar]
- Zheng, W.; Yang, X.; Lu, L.; He, S.; Jian, A.; Cao, H. Aeromonas schubertii: A potential pathogen for freshwater cultured whiteleg shrimp, Penaeus vannamei. Isr. J. Aquac.-Bamidgeh 2015, 67, 20732. [Google Scholar]
- Matyar, F. Identification and antibiotic resistance of bacteria isolated from shrimps. In Proceedings of the International Journal of Arts & Sciences, Rome, Italy, 31 October–3 November 2017; pp. 289–294. [Google Scholar]
- Mandal, S.; Mandal, M.; Pal, N.; Halder, P.; Basu, P. R-factor in Proteus vulgaris from ulcerative disease of fish, Channa punctatus. Indian J. Exp. Biol. 2002, 40, 614–616. [Google Scholar]
- Dai, H.; Wang, Y.; Fang, Y.; Huang, Z.; Kan, B.; Wang, D. Proteus alimentorum sp. nov., isolated from pork and lobster in Ma’anshan city, China. Int. J. Syst. Evol. 2018, 68, 1390–1395. [Google Scholar] [CrossRef]
- O’Hara, C.M.; Brenner, F.W.; Miller, J.M. Classification, identification, and clinical significance of Proteus, Providencia, and Morganella. Clin. Microbiol. Rev. 2000, 13, 534–546. [Google Scholar] [CrossRef]
- Hungerford, J.M. Scombroid poisoning: A review. Toxicon 2010, 56, 231–243. [Google Scholar] [CrossRef] [Green Version]
- Benner, R., Jr.; Staruszkiewicz, W.; Otwell, W. Putrescine, cadaverine, and indole production by bacteria isolated from wild and aquacultured penaeid shrimp stored at 0, 12, 24, and 36 °C. J. Food Prot. 2004, 67, 124–133. [Google Scholar] [CrossRef]
- Duran, G.M.; Marshall, D.L. Ready-to-eat shrimp as an international vehicle of antibiotic-resistant bacteria. J. Food Prot. 2005, 68, 2395–2401. [Google Scholar] [CrossRef]
- Al Shabeeb, S.S.; Ibrahim, M.M.; Ramadhan, G.A. A comparative microbial quality assessment among fishes, prawns and cuttlefishes collected from dammam fish market. Int. J. Curr. Microbiol. Appl. Sci. 2016, 5, 405–418. [Google Scholar] [CrossRef]
- Gu, C.T.; Li, C.Y.; Yang, L.J.; Huo, G.C. Enterobacter xiangfangensis sp. nov., isolated from Chinese traditional sourdough, and reclassification of Enterobacter sacchari Zhu et al. 2013 as Kosakonia sacchari comb. nov. Int. J. Syst. Evol. Microbiol. 2014, 64, 2650–2656. [Google Scholar] [CrossRef]
- Wenger, P.N.; Tokars, J.I.; Brennan, P.; Samel, C.; Bland, L.; Miller, M.; Carson, L.; Arduino, M.; Edelstein, P.; Aguero, S. An outbreak of Enterobacter hormaechei infection and colonization in an intensive care nursery. Clin. Infect. Dis. 1997, 24, 1243–1244. [Google Scholar] [CrossRef] [Green Version]
- Janda, J.M.; Abbott, S.L.; McIver, C.J. Plesiomonas shigelloides revisited. Clin. Microbiol. Rev. 2016, 29, 349–374. [Google Scholar] [CrossRef] [Green Version]
- Oxley, A.; Shipton, W.; Owens, L.; McKay, D. Bacterial flora from the gut of the wild and cultured banana prawn, Penaeus merguiensis. J. Appl. Microbiol. 2002, 93, 214–223. [Google Scholar] [CrossRef] [Green Version]
- Ye, L.; Jiang, S.; Zhu, X.; Yang, Q.; Wen, W.; Wu, K. Effects of salinity on growth and energy budget of juvenile Penaeus monodon. Aquaculture 2009, 290, 140–144. [Google Scholar] [CrossRef]
- Chand, B.; Trivedi, R.; Dubey, S.; Rout, S.; Beg, M.; Das, U. Effect of salinity on survival and growth of giant freshwater prawn Macrobrachium rosenbergii (de Man). Aquac. Rep. 2015, 2, 26–33. [Google Scholar] [CrossRef] [Green Version]
- Farmer, J.; Arduino, M.; Hickman-Brenner, F. The Genera Aeromonas and Plesiomonas. In Prokaryotes; Springer: Berlin/Heidelberg, Germany, 2006; Volume 6, pp. 564–596. [Google Scholar]
- Krovacek, K.; Eriksson, L.M.; González-Rey, C.; Rosinsky, J.; Ciznar, I. Isolation, biochemical and serological characterisation of Plesiomonas shigelloides from freshwater in Northern Europe. Comp. Immunol. Microbiol. Infect. Dis. 2000, 23, 45–51. [Google Scholar] [CrossRef]
- Mansouri, S.; Pahlavanzadeh, F. Hemolysin production, salt tolerance, antibacterial resistance, and prevalence of extended spectrum β-lactamases in Proteus bacilli isolated from clinical and environmental sources. Gene Rep. 2009, 2, 97–104. [Google Scholar]
- Reygaert, W.C. An overview of the antimicrobial resistance mechanisms of bacteria. AIMS Microb. 2018, 4, 482. [Google Scholar] [CrossRef]
- Zhang, Q.; Xiong, Q.; Xiao, L.; Yang, H.; Yang, X. A pathogen isolated from skin-ulcer Pseudosciaena crocea-Proteus mirabilis ZXS02 strain. J. Fish. China 2005, 29, 824–830. [Google Scholar]
- Samanidou, V.; Bitas, D.; Charitonos, S.; Papadoyannis, I. On the extraction of antibiotics from shrimps prior to chromatographic analysis. Separations 2016, 3, 8. [Google Scholar] [CrossRef]
- Wang, W.; Lin, H.; Xue, C.; Khalid, J. Elimination of chloramphenicol, sulphamethoxazole and oxytetracycline in shrimp, Penaeus chinensis following medicated-feed treatment. Environ. Int. 2004, 30, 367–373. [Google Scholar] [CrossRef]
- Granados-Chinchilla, F.; Rodríguez, C. Tetracyclines in food and feedingstuffs: From regulation to analytical methods, bacterial resistance, and environmental and health implications. J. Anal. Methods Chem. 2017, 2017, 1315497. [Google Scholar] [CrossRef]
- Khan, M.; Lively, J.A. Determination of sulfite and antimicrobial residue in imported shrimp to the USA. Aquac. Rep. 2020, 18, 100529. [Google Scholar] [CrossRef]
- Boonmar, S.; Bangtrakulnonth, A.; Pornruangwong, S.; Samosornsuk, S.; Kaneko, K.-I.; Ogawa, M. Significant increase in antibiotic resistance of Salmonella isolates from human beings and chicken meat in Thailand. Vet. Microbiol. 1998, 62, 73–80. [Google Scholar] [CrossRef]
- Dalsgaard, A.; Forslund, A.; Serichantalergs, O.; Sandvang, D. Distribution and content of class 1 integrons in different Vibrio cholerae O-serotype strains isolated in Thailand. Antimicrob. Agents Chemother. 2000, 44, 1315–1321. [Google Scholar] [CrossRef]
Primers | Sequences (5′–3′) | Primer Size (bp) | GC Content (%) | PCR Amplification Size (bp) |
---|---|---|---|---|
8F | AGAGTTTGATCCTGGCTCAG | 20 | 50.0% | 1484 |
1492R | GGTTACCTTGTTACGACTT | 19 | 42.1% |
Antimicrobial | Disc Content | Zone Diameter (mm) | ||
---|---|---|---|---|
Susceptible (S) | Intermediate (I) | Resistant (R) | ||
Ampicillin | 10 µg | ≥17 | 14–16 | ≤13 |
Ciprofloxacin | 5 µg | ≥21 | 16–20 | ≤15 |
Gentamicin | 10 µg | ≥15 | 13–14 | ≤12 |
Nitrofurantoin | 300 µg | ≥17 | 15–16 | ≤14 |
Levofloxacin | 5 µg | ≥17 | 14–16 | ≤13 |
Chloramphenicol | 30 µg | ≥18 | 13–17 | ≤12 |
Tetracycline | 30 µg | ≥15 | 12–14 | ≤11 |
Azithromycin | 15 µg | ≥13 | - | ≤12 |
Trimethoprim | 5 µg | ≥16 | 11–15 | ≤10 |
Source | Species | Isolates | Batches Found (Out of 3) | Accession Number * |
---|---|---|---|---|
MR sediment | P. penneri M. morganii | 7 6 | 3 1 | MN262212 MN262231 |
P. shigelloides | 1 | 1 | MN262458 | |
MR shrimp | P. penneri | 10 | 3 | MN262211, MN262213, MN262230, MN262440 |
P. alimentorum | 2 | 1 | MN262480 | |
E. hormaechei subsp. xiangfangensis | 3 | 1 | MN262441, MN262459 | |
PM sediment | P. penneri | 12 | 3 | MN262192, MN262439, MN262469 |
Source | Species (n) | Ampicillin | Ciprofloxacin | Gentamicin | Nitrofurantoin | Levoflox | Chloram | Oxytetracycline | Azithromycin | Co–Trimethoprim |
---|---|---|---|---|---|---|---|---|---|---|
MR sediment | P. penneri (7) | 0 ^–11 ^ | 34–46 | 15–21 | 18 ^–31 ^ | 29–45 | 19–37 | 15 ^–37 ^ | 0–33 | 31–42 |
P. shigelloides (1) | 21 | 54 | 12 | 21 | 49 | 33 | 35 | 26 | 40 | |
M. morganii (6) | 0 ^–8 ^ | 36–43 | 16–19 | 16^–29 ^ | 26–39 | 25–35 | 17–31 | 0–22 | 29–32 | |
MR shrimp | P. alimentorum (2) | 0 ^–0 ^ | 15–19 | 8–14 | 15–17 | 9–17 | 0–10 | 11–19 | 0 ^–14 ^ | 21–26 |
P. penneri (10) | 0–13 ^ | 18–42 | 0–17 | 15 ^–28 ^ | 19–38 | 0–39 | 15 ^–30 ^ | 0–26 | 28–32 | |
E. h. subsp. xiangfangensis (3) | 0 ^–0 ^ | 27–30 | 15–17 | 0–20 | 22–28 | 0–10 | 0–24 | 12–22 | 10–13 | |
PM sediment | P. penneri (12) | 0 ^–13 ^ | 20–47 | 8–20 | 0 ^–30 ^ | 19–38 | 13–36 | 15 ^–36 ^ | 0–17 | 30–36 |
Total species (per source) resistant * | 0/1 | 1/7 | 4/7 | 1/3 | 1/7 | 3/7 | 2/4 | 5/6 | 1/7 |
Isolated Species | Total Isolates | Isolates Resistant | Isolates Multidrug Resistant |
---|---|---|---|
P. pennari | 29 | 24 | 8 |
M. morganii | 6 | 2 | 0 |
P. shigelloides | 1 | 1 | 0 |
P. alimentorum | 2 | 2 | 2 |
E. h. subsp. xiangfangensis | 3 | 2 | 2 |
41 | 31 (78.04%) | 12 (29.26%) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khan, M.; Paul, S.I.; Rahman, M.M.; Lively, J.A. Antimicrobial Resistant Bacteria in Shrimp and Shrimp Farms of Bangladesh. Water 2022, 14, 3172. https://doi.org/10.3390/w14193172
Khan M, Paul SI, Rahman MM, Lively JA. Antimicrobial Resistant Bacteria in Shrimp and Shrimp Farms of Bangladesh. Water. 2022; 14(19):3172. https://doi.org/10.3390/w14193172
Chicago/Turabian StyleKhan, Murshida, Sulav Indra Paul, Md. Mahbubur Rahman, and Julie Anderson Lively. 2022. "Antimicrobial Resistant Bacteria in Shrimp and Shrimp Farms of Bangladesh" Water 14, no. 19: 3172. https://doi.org/10.3390/w14193172